Update faq.md

faq.md

@@ -33,7 +33,7 @@ This shift represents a move towards a clearer and more informative style that e
 
 **Q: Why are insertions following a SNP notated differently in `covSonar2` compared to `covSonar`?**
 
-**A:** In covSonar2, the notation for insertions following a single nucleotide polymorphism (SNP) has been refined to accurately reflect their position within the genomic coordinate system, providing improved clarity and specificity. Unlike covSonar, which previously used a condensed mutation notation, covSonar2 employs a more explicit approach.
+**A:** In `covSonar2`, the notation for insertions following a single nucleotide polymorphism (SNP) has been refined to accurately reflect their position within the genomic coordinate system, providing improved clarity and specificity. Unlike covSonar, which previously used a condensed mutation notation, covSonar2 employs a more explicit approach.
 
 In the case of insertions the base directly before the insertion, known as the anchor base, is used to reference the insertion's location. Let's consider the following example:
 
@@ -43,7 +43,7 @@ Reference Sequence:      ATGCCATGATT-----AGGAATTCTGA
 Sequence with Insertion: ATGCCATGATTGTTTAAGGAATTCTGA
 ```
 
-Both covSonar and covSonar2 would notate this insertion as `T11TGTTTA`. However, it's important to note that the `T` at position 11 is not part of the insertion itself; it serves as an anchor base to indicate the insertion's position.
+Both `covSonar` and `covSonar2` would notate this insertion as `T11TGTTTA`. However, it's important to note that the `T` at position 11 is not part of the insertion itself; it serves as an anchor base to indicate the insertion's position.
 
 In rare cases, the anchor base itself might be mutated, leading to scenarios like:
 
@@ -53,7 +53,7 @@ Reference Sequence:                    ATGCCATGATT-----AGGAATTCTGA
 Sequence with SNP preceding Insertion: ATGCCATGATAGTTTAAGGAATTCTGA
 ```
 
-In such cases, covSonar2 addresses the complexity more explicitly. While covSonar used to express this as a single mutation (`T11AGTTTA`), which might not accurately represent both independent mutation events, covSonar2 dissects the mutations into separate notations. This approach references both independent mutational events as `T11A` and `T11TGTTTA` in the genomic profile. This distinction  also ensures accurate matching and interpretation of the mutations independently from each other.
+In such cases, `covSonar2` addresses the complexity more explicitly. While covSonar used to express this as a single mutation (`T11AGTTTA`), which might not accurately represent both independent mutation events, `covSonar2` dissects the mutations into separate notations. This approach references both independent mutational events as `T11A` and `T11TGTTTA` in the genomic profile. This distinction  also ensures accurate matching and interpretation of the mutations independently from each other.
 
 **Q: Why are some deletions very close to one of the sequence termini missing in the genomic profile of `covSonar2`?**