Add updated tests.

README.rst

@@ -78,7 +78,7 @@ Acts like a dictionary.
     >>> len(genes['NM_001282543.1'])
     5466
 
-Note that start and end coordinates of Sequence objects are [1, 0]. This can be changed to [0, 0] by passing ``one_based_attributes=False`` to ``Fasta`` or ``Faidx``.
+Note that start and end coordinates of Sequence objects are [1, 0]. This can be changed to [0, 0] by passing ``one_based_attributes=False`` to ``Fasta`` or ``Faidx``. This argument only affects the ``Sequence .start/.end`` attributes, and has no effect on slicing coordinates.
 
 Indexes like a list:
 
@@ -181,18 +181,18 @@ Or just get a Python string:
 
     >>> genes['NM_001282543.1'][200:230]
     CTCGTTCCGCGCCCGCCATGGAACCGGATG
-    
+
 You can make sure that you always receive an uppercase sequence, even if your fasta file has lower case
 
 .. code:: python
-   
+
     >>> from pyfaidx import Fasta
     >>> reference = Fasta('tests/data/genes.fasta.lower', sequence_always_upper=True)
     >>> reference['gi|557361099|gb|KF435150.1|'][1:70]
-    
+
     >gi|557361099|gb|KF435150.1|:2-70
     TGACATCATTTTCCACCTCTGCTCAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAAA
-    
+
 
 You can also perform line-based iteration, receiving the sequence lines as they appear in the FASTA file:
 
@@ -386,11 +386,11 @@ For usage type ``faidx -h``.
     CCCCGCCCCTCTGGCGGCCCGCCGTCCCAGACGCGGGAAGAGCTTGGCCGGTTTCGAGTCGCTGGCCTGC
     AGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTCTGCGAGGAGCCTTTCATCCGAAGGCGGGA
     .......
-    
-    $ faidx -m --bed regions.bed tests/data/genes.fasta 
+
+    $ faidx -m --bed regions.bed tests/data/genes.fasta
     ### Modifies tests/data/genes.fasta by masking regions using --default-seq character ###
-    
-    $ faidx -M --bed regions.bed tests/data/genes.fasta 
+
+    $ faidx -M --bed regions.bed tests/data/genes.fasta
     ### Modifies tests/data/genes.fasta by masking regions using lowercase characters ###
 
 
@@ -431,16 +431,16 @@ comprehensive list of version changes.
 Contributing
 ------------
 
-Create a new Pull Request with one feauture. If you add a new feature, please 
+Create a new Pull Request with one feauture. If you add a new feature, please
 create also the relevant test.
 
 To get test running on your machine:
- - Create a new virtualenv and install the `dev-requirements.txt`. 
+ - Create a new virtualenv and install the `dev-requirements.txt`.
  - Download the test data running:
 
       python tests/data/download_gene_fasta.py
-   
- - Run the tests with 
+
+ - Run the tests with
 
       nosetests --with-coverage --cover-package=pyfaidx
 

setup.py

@@ -35,6 +35,7 @@ def get_version(string):
             "Intended Audience :: Science/Research",
             "Natural Language :: English",
             "Operating System :: Unix",
+            "Programming Language :: Python :: 3.5",
             "Programming Language :: Python :: 3.4",
             "Programming Language :: Python :: 3.3",
             "Programming Language :: Python :: 3.2",

tests/test_feature_bounds_check.py

@@ -101,3 +101,28 @@ def test_slice_from_beginning(self):
     def test_slice_from_end(self):
         fasta = Fasta('data/genes.fasta', as_raw=True)
         assert fasta['gi|557361099|gb|KF435150.1|'][-4:] == 'ACTC'
+
+    def test_issue_74_start(self):
+        f0 = Fasta('data/genes.fasta', one_based_attributes=False)
+        f1 = Fasta('data/genes.fasta', one_based_attributes=True)
+        assert f0['gi|557361099|gb|KF435150.1|'][0:90].start == f1['gi|557361099|gb|KF435150.1|'][0:90].start - 1
+
+    def test_issue_74_consistency(self):
+        f0 = Fasta('data/genes.fasta', one_based_attributes=False)
+        f1 = Fasta('data/genes.fasta', one_based_attributes=True)
+        assert str(f0['gi|557361099|gb|KF435150.1|'][0:90]) == str(f1['gi|557361099|gb|KF435150.1|'][0:90])
+
+    def test_issue_74_end_faidx(self):
+        f0 = Faidx('data/genes.fasta', one_based_attributes=False)
+        f1 = Faidx('data/genes.fasta', one_based_attributes=True)
+        end0 = f0.fetch('gi|557361099|gb|KF435150.1|', 1, 90).end
+        end1 = f1.fetch('gi|557361099|gb|KF435150.1|', 1, 90).end
+        assert end0 == end1
+
+    def test_issue_74_end_fasta(self):
+        f0 = Fasta('data/genes.fasta', one_based_attributes=False)
+        f1 = Fasta('data/genes.fasta', one_based_attributes=True)
+        end0 = f0['gi|557361099|gb|KF435150.1|'][1:90].end
+        end1 = f1['gi|557361099|gb|KF435150.1|'][1:90].end
+        print((end0, end1))
+        assert end0 == end1

tests/test_sequence_class.py

@@ -6,9 +6,6 @@
 
 seq_invalid = Sequence(name='gi|557361099|gb|KF435150.1|', seq='TTGAAGATTTPGCATGCAGCAGGTGCGCAAGGTGAAATNTTCACTGTTAAA',
                     start=100, end=150)
-
-seq_0 = Sequence(name='gi|557361099|gb|KF435150.1|', seq='TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA',
-                    start=100, end=150, one_based_attributes=False)                    
 
 comp_valid = 'TTGAAGATTTnGCATGCAGCAGGtgccaAGGTGAAATGTTNACTGTTAAA'
 
@@ -37,6 +34,3 @@ def test_comp_invalid():
 
 def test_comp_valid():
     complement(comp_valid)
-
-def test_zero_start():
-    assert seq_0.start == seq.start - 1