-
Notifications
You must be signed in to change notification settings - Fork 75
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Browse files
Browse the repository at this point in the history
- Loading branch information
Showing
2 changed files
with
29 additions
and
29 deletions.
There are no files selected for viewing
This file was deleted.
Oops, something went wrong.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,29 @@ | ||
import os | ||
from pyfaidx import Faidx, Fasta | ||
from nose.tools import raises | ||
|
||
path = os.path.dirname(__file__) | ||
os.chdir(path) | ||
|
||
|
||
class TestFeatureSplitChar: | ||
def __init__(self): | ||
self.fasta = os.path.join(path, 'data/genes.fasta') | ||
self.faidx = Faidx(self.fasta, split_char='.') | ||
self.genes = Fasta(self.fasta, split_char='.') | ||
|
||
def test_keys(self): | ||
expect = ['3', 'AB821309', 'KF435149', 'KF435150', 'NM_000465', 'NM_001282543', 'NM_001282545', 'NM_001282548', 'NM_001282549', 'NR_104212', 'NR_104215', 'NR_104216', 'XM_005249642', 'XM_005249643', 'XM_005249644', 'XM_005249645', 'XM_005265507', 'XM_005265508', 'XR_241079', 'XR_241080', 'XR_241081'] | ||
result = sorted(self.genes.keys()) | ||
assert result == expect | ||
|
||
def test_key_function_by_dictionary_get_key(self): | ||
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA' | ||
result = self.genes['KF435150'][100-1:150] | ||
assert str(result) == expect | ||
|
||
def test_key_function_by_fetch(self): | ||
expect = 'TTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACTGTTAAA' | ||
result = self.faidx.fetch('KF435150', | ||
100, 150) | ||
assert str(result) == expect |