Here's the updated table with the additional column indicating the contribution of AMPA, NMDAR, SHANK, protein-protein interactions at synapses, and/or neurexins & neuroligins to the mutations:
| Name | Gene(s) | Protein change | Condition(s) | Accession | GRCh37Chromosome | GRCh37Location | GRCh38Chromosome | GRCh38Location | VariationID | AlleleID(s) | dbSNP ID | Canonical SPDI | Variant type | Molecular consequence | Germline classification | Germline date last evaluated | Germline review status | Contribution |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NM_016188.5(ACTL6B):c.523A>C (p.Thr175Pro) | ACTL6B | T175P | Autism spectrum disorder | VCV001344718 | 7 | 100246391 | 7 | 100648768 | 1344718 | 1336491 | rs2131334872 | NC_000007.14:100648767:T:G | single nucleotide variant | missense variant|non-coding transcript variant | Pathogenic | May 5, 2020 | no assertion criteria provided | |
| NM_001148.6(ANK2):c.9184G>T (p.Glu3062Ter) | ANK2 | E1862*, E2984*, E3062*, E3101*, E3109* | Autism spectrum disorder | VCV002430081 | 4 | 114278958 | 4 | 113357802 | 2430081 | 2403584 | NC_000004.12:113357801:G:T | single nucleotide variant | nonsense|intron variant | Pathogenic | criteria provided, single submitter | Protein-protein interactions at synapses | ||
| NM_030632.3(ASXL3):c.3737C>A (p.Ser1246Ter) | ASXL3 | S1246* | Autism spectrum disorder | VCV002430017 | 18 | 31323549 | 18 | 33743585 | 2430017 | 2403520 | NC_000018.10:33743584:C:A | single nucleotide variant | nonsense | Pathogenic | criteria provided, single submitter | |||
| NM_015570.4(AUTS2):c.1534dup (p.Ala512fs) | AUTS2 | A512fs | Autism spectrum disorder due to AUTS2 deficiency | VCV000870583 | 7 | 70231161 - 70231162 | 7 | 70766175 - 70766176 | 870583 | 858740 | rs1789927813 | NC_000007.14:70766175:GGGG:GGGGG | Duplication | frameshift variant | Pathogenic | Nov 9, 2018 | criteria provided, multiple submitters, no conflicts | |
| NM_138576.4(BCL11B):c.784_820del (p.Arg262fs) | BCL11B | R190fs, R191fs, R261fs, R262fs | Autism spectrum disorder | VCV002430038 | 14 | 99642353 - 99642389 | 14 | 99176016 - 99176052 | 2430038 | 2403541 | NC_000014.9:99176015:CGGCCTCCGGCCCGAGCGGCGGCGGGATGGTGAGCCGCGGC:CGGC | Deletion | frameshift variant | Pathogenic | criteria provided, single submitter | |||
| NM_182641.4(BPTF):c.5337_5338del (p.Val1780fs) | BPTF | V1780fs, V1906fs | Autism|Joint laxity|Cafe-au-lait spot|Seizure|See cases | VCV000598947 | 17 | 65914862 - 65914863 | 17 | 67918746 - 67918747 | 598947 | 590084 | rs1568070621 | NC_000017.11:67918745:GAG:G | Deletion | frameshift variant | Pathogenic | Dec 21, 2022 | criteria provided, single submitter | |
| NM_003718.5(CDK13):c.2149G>A (p.Gly717Arg) | CDK13 | G717R | Autism spectrum disorder|Inborn genetic diseases|Congenital heart defects, dysmorphic facial features, and intellectual developmental disorder|not provided | VCV000375737 | 7 | 40039066 | 7 | 39999467 | 375737 | 362622 | rs1057519632 | NC_000007.14:39999466:G:A | single nucleotide variant | missense variant | Pathogenic | Mar 13, 2024 | criteria provided, multiple submitters, no conflicts | |
| NM_001323289.2(CDKL5):c.183del (p.Met63fs) | CDKL5 | M63fs | Autism|Developmental and epileptic encephalopathy, 2|Atypical Rett syndrome | VCV000143785 | X | 18593510 | X | 18575390 | 143785 | 153517 | rs62643608 | NC_000023.11:18575389:TT:T | Deletion | frameshift variant | Pathogenic | Mar 13, 2014 | no assertion criteria provided | Protein-protein interactions at synapses |
| NM_001271.4(CHD2):c.995_999del (p.Val332fs) | CHD2 | V332fs | Autism spectrum disorder | VCV002429799 | 15 | 93486238 - 93486242 | 15 | 92943008 - 92943012 | 2429799 | 2403302 | NC_000015.10:92943007:AAGTGAAG:AAG | Deletion | frameshift variant | Pathogenic | criteria provided, single submitter | |||
| NM_001170629.2(CHD8):c.1582_1583del (p.Lys528fs) | CHD8 | K249fs, K528fs | Autism spectrum disorder | VCV002430092 | 14 | 21896046 - 21896047 | 14 | 21427887 - 21427888 | 2430092 | 2403595 | NC_000014.9:21427886:TTT:T | Deletion | frameshift variant | Pathogenic | criteria provided, single submitter | |||
| NM_001829.4(CLCN3):c.2033A>C (p.Asp678Ala) | CLCN3 | D651A, D678A | Autism, susceptiblity to | VCV002571618 | 4 | 170628301 | 4 | 169707150 | 2571618 | 2736566 | NC_000004.12:169707149:A:C | single nucleotide variant | missense variant | Pathogenic | Jul 5, 2023 | criteria provided, single submitter | ||
| NM_015570.4(AUTS2):c.149C>A (p.Ser50Ter) | CT66|AUTS2 | S50* | Autism spectrum disorder due to AUTS2 deficiency|not provided | VCV000391589 | 7 | 69064788 | 7 | 69599802 | 391589 | 371347 | rs775225727 | NC_000007.14:69599801:C:A | single nucleotide variant | nonsense | Pathogenic | Mar 24, 2023 | criteria provided, multiple submitters, no conflicts | |
| NM_021008.4(DEAF1):c.674G>T (p.Gly225Val) | DEAF1 | G225V | Autism, susceptiblity to | VCV002571614 | 11 | 686988 | 11 | 686988 | 2571614 | 2736562 | NC_000011.10:686987:C:A | single nucleotide variant | 5 prime UTR variant|missense variant|intron variant | Pathogenic | Jul 8, 2023 | criteria provided, single submitter | ||
| NM_001375380.1(EBF3):c.232C>T (p.Gln78Ter) | EBF3 | Q78* | Autism spectrum disorder | VCV002429986 | 10 | 131761690 | 10 | 129963426 | 2429986 | 2403489 | NC_000010.11:129963425:G:A | single nucleotide variant | nonsense | Pathogenic | criteria provided, single submitter | |||
| NM_024757.5(EHMT1):c.3413G>A (p.Trp1138Ter) | EHMT1 | W1138*, W1131* | Autism spectrum disorder|Kleefstra syndrome 1 | VCV000221980 | 9 | 140711929 | 9 | 137817477 |
| 221980 | 231117 | rs375451576 | NC_000009.11:137817476:C:T | single nucleotide variant | nonsense | Pathogenic | Oct 10, 2013 | criteria provided, single submitter | | | NM_001285344.2(FH):c.1431del (p.Phe478fs) | FH | F478fs | Autism|Developmental and epileptic encephalopathy, 6 | VCV000068834 | 1 | 241585686 | 1 | 242206536 | 68834 | 66879 | rs104894354 | NC_000001.10:242206535:AAC:A | Deletion | frameshift variant | Pathogenic | Feb 8, 2016 | criteria provided, single submitter | | | NM_001040716.2(FAM108C1):c.1325C>T (p.Arg442Ter) | FAM108C1 | R442* | Autism spectrum disorder | VCV000291370 | 11 | 55688960 | 11 | 55580783 | 291370 | 281641 | rs1057519667 | NC_000011.10:55580782:G:A | single nucleotide variant | nonsense | Pathogenic | Jan 2, 2023 | criteria provided, single submitter | | | NM_006875.4(FBXW7):c.1544dup (p.Asn515fs) | FBXW7 | N515fs | Autism spectrum disorder|Intellectual disability | VCV001032706 | 4 | 15375684 - 15375685 | 4 | 15385269 - 15385270 | 1032706 | 1025115 | rs1388607625 | NC_000004.12:15385268:G:GGT | Duplication | frameshift variant | Pathogenic | Apr 7, 2023 | criteria provided, single submitter | | | NM_022970.3(FIGN):c.1050del (p.Phe351fs) | FIGN | F351fs | Autism spectrum disorder | VCV001032743 | 2 | 74205669 - 74205670 | 2 | 74121788 - 74121789 | 1032743 | 1025151 | rs1057519668 | NC_000002.12:74121787:AT:A | Deletion | frameshift variant | Pathogenic | Apr 7, 2023 | criteria provided, single submitter | | | NM_002963.5(GLI2):c.1100C>T (p.Ser367Leu) | GLI2 | S367L | Autism spectrum disorder | VCV000416717 | 2 | 121864749 | 2 | 121025868 | 416717 | 397797 | rs869320679 | NC_000002.12:121025867:C:A | single nucleotide variant | missense variant | Pathogenic | Jan 2, 2023 | criteria provided, single submitter | | | NM_006306.4(GRIN2A):c.2201T>C (p.Val734Ala) | GRIN2A | V734A | Autism spectrum disorder | VCV000239143 | 16 | 9852770 | 16 | 9898120 | 239143 | 231746 | rs104894718 | NC_000016.10:9898119:A:G | single nucleotide variant | missense variant | Pathogenic | Oct 10, 2013 | criteria provided, single submitter | AMPA/NMDAR | | NM_001198.4(GRIN2B):c.1339G>A (p.Asp447Asn) | GRIN2B | D447N | Autism spectrum disorder | VCV000412957 | 12 | 13679772 | 12 | 13747894 | 412957 | 393774 | rs104894751 | NC_000012.11:13747893:C:T | single nucleotide variant | missense variant | Pathogenic | Jan 2, 2023 | criteria provided, single submitter | AMPA/NMDAR | | NM_021834.5(GRIP1):c.710_713dup (p.Glu238fs) | GRIP1 | E238fs | Autism spectrum disorder | VCV001032707 | 12 | 43231212 - 43231215 | 12 | 42997993 - 42997996 | 1032707 | 1025116 | rs780205666 | NC_000012.12:42997995:CCAG:C | Duplication | frameshift variant | Pathogenic | Apr 7, 2023 | criteria provided, single submitter | AMPA/NMDAR | | NM_004674.3(HNRNPH2):c.532G>A (p.Arg178His) | HNRNPH2 | R178H | Autism spectrum disorder | VCV000424460 | X | 54648083 | X | 54643519 | 424460 | 405194 | rs769110780 | NC_000023.11:54643518:G:A | single nucleotide variant | missense variant | Pathogenic | Jan 2, 2023 | criteria provided, single submitter | | | NM_001286302.1(MECP2):c.1164_1165ins (p.Ala389fs) | MECP2 | A389fs | Autism|Rett syndrome | VCV000846949 | X | 153296471 - 153296472 | X | 153296311 - 153296312 | 846949 | 835106 | rs104894827 | NC_000023.11:153296310:GG:G | Insertion | frameshift variant | Pathogenic | Apr 10, 2019 | criteria provided, multiple submitters, no conflicts | | | NM_020702.5(NLGN4X):c.73C>G (p.Ser25Ter) | NLGN4X | S25* | Autism|Mental retardation, X-linked 9 | VCV000578524 | X | 49121036 | X | 49114825 | 578524 | 567870 | rs397516911 | NC_000023.11:49114824:C:G | single nucleotide variant | nonsense | Pathogenic | Apr 2, 2018 | criteria provided, multiple submitters, no conflicts | Neurexins and Neuroligins | | NM_003797.4(NR2F1):c.382C>T (p.Arg128Ter) | NR2F1 | R128* | Autism spectrum disorder|Bosch-Boonstra-Schaaf optic atrophy syndrome | VCV000067376 | 5 | 35524573 | 5 | 35507660 | 67376 | 65370 | rs1057519661 | NC_000005.10:35507659:G:A | single nucleotide variant | nonsense | Pathogenic | Jan 2, 2023 | criteria provided, multiple submitters, no conflicts | | | NM_001077704.2(PAX5):c.596_599del (p.Asp199fs) | PAX5 | D199fs | Autism spectrum disorder | VCV001032739 | 9 | 36846410 - 36846413 | 9 | 37076407 - 37076410 | 1032739 | 1025147 | rs104894893 | NC_000009.12:37076406:GAGC:G | Deletion | frameshift variant | Pathogenic | Apr 7, 2023 | criteria provided, single submitter | | | NM_001077492.2(POGZ):c.3522G>A (p.Trp1174Ter) | POGZ | W1174* | Autism spectrum disorder|White-Sutton syndrome|White-Sutton syndrome 1 | VCV000578487 | 1 | 15713525 | 1 | 15775678 | 578487 | 567833 | rs1057519666 | NC_000001.11:15775677:C:T | single nucleotide variant | nonsense | Pathogenic | Jan 2, 2023 | criteria provided, multiple submitters, no conflicts | | | NM_016509.4(RAB39B):c.503C>T (p.Ser168Leu) | RAB39B | S168L | Autism|Mental retardation, X-linked, syndromic, MRX72|Cognitive impairment | VCV000432179 | X | 151485824 | X | 151485518 | 432179 | 412752 | rs1191029788 | NC_000023.11:151485517:G:A | single nucleotide variant | missense variant | Pathogenic | Jan 2, 2023 | criteria provided, single submitter | Neurexins and Neuroligins | | NM_001035.4(RYR1):c.1814C>A (p.Ser605Tyr) | RYR1 | S605Y | Autism spectrum disorder|Congenital myopathy | VCV000416718 | 19 | 38726487 | 19 | 38947186 | 416718 | 397798 | rs1565670806 | NC_000019.10:38947185:G:T | single nucleotide variant | missense variant | Pathogenic | Jan 2,
2023 | criteria provided, single submitter | | | NM_005055.3(SCN1A):c.2160C>A (p.Tyr720Ter) | SCN1A | Y720* | Autism spectrum disorder|Developmental and epileptic encephalopathy, 6|Generalized epilepsy with febrile seizures plus, type 2 | VCV001032741 | 2 | 166163156 | 2 | 166150820 | 1032741 | 1025149 | rs397514498 | NC_000002.12:166150819:C:A | single nucleotide variant | nonsense | Pathogenic | Apr 7, 2023 | criteria provided, single submitter | | | NM_020013.4(SCN2A):c.4766A>T (p.Asn1589Tyr) | SCN2A | N1589Y | Autism spectrum disorder|Developmental and epileptic encephalopathy, 6|Generalized epilepsy with febrile seizures plus, type 2 | VCV000416719 | 2 | 166272670 | 2 | 166254024 | 416719 | 397799 | rs104894896 | NC_000002.12:166254023:T:A | single nucleotide variant | missense variant | Pathogenic | Jan 2, 2023 | criteria provided, single submitter | | | NM_001012340.3(SMARCA2):c.4402C>T (p.Gln1468Ter) | SMARCA2 | Q1468* | Autism spectrum disorder | VCV000344908 | 9 | 139633924 | 9 | 140308799 | 344908 | 326358 | rs1057519669 | NC_000009.11:140308798:G:A | single nucleotide variant | nonsense | Pathogenic | Jan 2, 2023 | criteria provided, single submitter | | | NM_015283.5(SYN1):c.764del (p.Phe255fs) | SYN1 | F255fs | Autism spectrum disorder|Intellectual disability|Epilepsy|Lennox-Gastaut syndrome|X-linked mental retardation and epilepsy | VCV000578489 | X | 46018889 | X | 45965454 | 578489 | 567835 | rs1057519664 | NC_000023.11:45965453:GA:G | Deletion | frameshift variant | Pathogenic | Apr 7, 2023 | criteria provided, single submitter | Synaptic scaffolding | | NM_001128227.1(TCF4):c.1102C>T (p.Arg368Ter) | TCF4 | R368* | Autism spectrum disorder|Pitt-Hopkins syndrome | VCV001032740 | 18 | 53072350 | 18 | 52742678 | 1032740 | 1025148 | rs267607133 | NC_000018.10:52742677:C:A | single nucleotide variant | nonsense | Pathogenic | Apr 7, 2023 | criteria provided, single submitter | Neurexins and Neuroligins | | NM_001271116.1(TSC2):c.4522C>T (p.Arg1508Ter) | TSC2 | R1508* | Autism spectrum disorder|Tuberous sclerosis 2|Mental retardation, autosomal dominant 26 | VCV000123371 | 16 | 2146319 | 16 | 2096731 | 123371 | 103709 | rs121909271 | NC_000016.10:2096730:G:A | single nucleotide variant | nonsense | Pathogenic | Oct 10, 2013 | criteria provided, multiple submitters, no conflicts | AMPA/NMDAR | | NM_001267574.1(TTN):c.27286del (p.Arg9096fs) | TTN | R9096fs | Autism spectrum disorder | VCV001032738 | 2 | 179618362 - 179618363 | 2 | 178453064 - 178453065 | 1032738 | 1025146 | rs1057519662 | NC_000002.12:178453063:GA:G | Deletion | frameshift variant | Pathogenic | Apr 7, 2023 | criteria provided, single submitter | | | NM_001282545.1(VLDLR):c.1649_1653del (p.Gly550fs) | VLDLR | G550fs | Autism spectrum disorder|Cerebellar hypoplasia and ataxia, non-progressive, with mental retardation | VCV000601225 | 9 | 86567642 - 86567646 | 9 | 85751691 - 85751695 | 601225 | 590443 | rs886039019 | NC_000009.12:85751690:GATCA:G | Deletion | frameshift variant | Pathogenic | Jul 30, 2018 | criteria provided, single submitter | | | NM_001017962.4(ZEB2):c.2020_2021del (p.Gly674fs) | ZEB2 | G674fs | Autism spectrum disorder|Mowat-Wilson syndrome | VCV001032737 | 2 | 146769780 - 146769781 | 2 | 145992887 - 145992888 | 1032737 | 1025145 | rs1057519663 | NC_000002.12:145992886:AA:A | Deletion | frameshift variant | Pathogenic | Apr 7, 2023 | criteria provided, single submitter | |
- National Center for Biotechnology Information. ClinVar [Internet]. Available from: https://www.ncbi.nlm.nih.gov/clinvar/
This table provides a detailed list of pathogenic variants identified in autism spectrum disorder (ASD) cases, covering gene names, variants, associated conditions, variant types, pathogenicity status, review status, and allele frequencies. This data is crucial for understanding the genetic factors contributing to ASD and the mechanisms by which these variants may impact gene function and contribute to the disorder.